Cherry SNP DataBase

SNP information

Name Pav_sc0003426.1_33618K
Chr PAV_r1.0chr2
Pos (Chr) 4156512
PAV_r1.0 Pav_sc0003426.1
Pos (PAV_r1.0) 33618
REF G
ALT T
SSR motif
Gene Name Pav_sc0003426.1_g050.1.mk
Annotation PREDICTED: calcium/calmodulin-dependent serine/threonine-protein kinase-like
snpEff Effect splice_region_variant&intron_variant
Impact LOW
Codon c.895-6C>A
Amino Acid
PCR Forward primer TTTCATCCGGTTTAAGGTCG
Reverse primer CAACTTGGCATGGGTTGTAA
Product size 326
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/REF REF/REF REF/ALT REF/REF


| Top |