Cherry SNP DataBase

SNP information

Name Pav_sc0003426.1_33858M
Chr PAV_r1.0chr2
Pos (Chr) 4156272
PAV_r1.0 Pav_sc0003426.1
Pos (PAV_r1.0) 33858
REF C
ALT A
SSR motif
Gene Name Pav_sc0003426.1_g050.1.mk
Annotation PREDICTED: calcium/calmodulin-dependent serine/threonine-protein kinase-like
snpEff Effect synonymous_variant
Impact LOW
Codon c.849G>T
Amino Acid p.Ser283Ser
PCR Forward primer ATGGATGGTCCAGAAGCTGT
Reverse primer TCCTGCAGGGAGAATTCAGT
Product size 335
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |