Cherry SNP DataBase

SNP information

Name Pav_sc0003492.1_179895S
Chr PAV_r1.0chr4
Pos (Chr) 13086566
PAV_r1.0 Pav_sc0003492.1
Pos (PAV_r1.0) 179895
REF C
ALT G
SSR motif
Gene Name Pav_sc0003492.1_g370.1.mk
Annotation PREDICTED: 28 kDa heat- and acid-stable phosphoprotein-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.105+392C>G
Amino Acid
PCR Forward primer CAGGCAATGGGTACATGACA
Reverse primer GGGTTTTTCGTAGAAGGCAA
Product size 344
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/REF REF/REF


| Top |