Cherry SNP DataBase

SNP information

Name Pav_sc0003521.1_5047K
Chr PAV_r1.0chr0
Pos (Chr) 65916205
PAV_r1.0 Pav_sc0003521.1
Pos (PAV_r1.0) 5047
REF T
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.5047T>G
Amino Acid
PCR Forward primer AGAACGTTGTTGGGGATCAG
Reverse primer GCAAAACAGAAGCAAAAGGC
Product size 350
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT -/- REF/ALT REF/ALT ALT/ALT REF/ALT


| Top |