Cherry SNP DataBase

SNP information

Name Pav_sc0003565.1_29999Y
Chr PAV_r1.0chr3
Pos (Chr) 7847825
PAV_r1.0 Pav_sc0003565.1
Pos (PAV_r1.0) 29999
REF T
ALT C
SSR motif
Gene Name Pav_sc0003565.1_g040.1.mk
Annotation PREDICTED: serine/threonine-protein kinase fray2
snpEff Effect intron_variant
Impact MODIFIER
Codon c.418-200A>G
Amino Acid
PCR Forward primer TCCCAGCCTATCAGAAGCAT
Reverse primer GCAAAACAACAGTTCATCCG
Product size 342
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |