Cherry SNP DataBase

SNP information

Name Pav_sc0003582.1_50523S
Chr PAV_r1.0chr8
Pos (Chr) 17080468
PAV_r1.0 Pav_sc0003582.1
Pos (PAV_r1.0) 50523
REF C
ALT G
SSR motif
Gene Name Pav_sc0003582.1_g090.1.mk
Annotation PREDICTED: 3-ketoacyl-CoA thiolase 2, peroxisomal
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1111+140C>G
Amino Acid
PCR Forward primer TGTGATGACACAAACAGGCA
Reverse primer GGATATCACACCAAAGCGGT
Product size 226
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |