Cherry SNP DataBase

SNP information

Name Pav_sc0003690.1_13316K
Chr PAV_r1.0chr7
Pos (Chr) 5166300
PAV_r1.0 Pav_sc0003690.1
Pos (PAV_r1.0) 13316
REF G
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.13316G>T
Amino Acid
PCR Forward primer GCTCTGCAAATTCTTGTGGA
Reverse primer GCAATCATTTTCATCAGGGAA
Product size 206
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT -/- REF/ALT REF/REF REF/ALT REF/ALT


| Top |