Cherry SNP DataBase

SNP information

Name Pav_sc0004023.1_43162Y
Chr PAV_r1.0chr1
Pos (Chr) 16360078
PAV_r1.0 Pav_sc0004023.1
Pos (PAV_r1.0) 43162
REF T
ALT C
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.43162T>C
Amino Acid
PCR Forward primer GCGAAGGAGCCTAGAATGTG
Reverse primer AAGGCAGGGAATGAGTGATG
Product size 284
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF ALT/ALT REF/ALT REF/REF ALT/ALT REF/ALT REF/ALT


| Top |