Cherry SNP DataBase

SNP information

Name Pav_sc0004354.1_132915Y
Chr PAV_r1.0chr1
Pos (Chr) 40027706
PAV_r1.0 Pav_sc0004354.1
Pos (PAV_r1.0) 132915
REF C
ALT T
SSR motif
Gene Name Pav_sc0004354.1_g240.1.mk
Annotation PREDICTED: synaptojanin-1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.126+1036C>T
Amino Acid
PCR Forward primer CGCTTAGCGTTGATGGATCT
Reverse primer GAACGCAGACTACGTGGTGA
Product size 259
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |