Cherry SNP DataBase

SNP information

Name Pav_sc0004456.1_102715R
Chr PAV_r1.0chr6
Pos (Chr) 23962658
PAV_r1.0 Pav_sc0004456.1
Pos (PAV_r1.0) 102715
REF A
ALT G
SSR motif
Gene Name Pav_sc0004456.1_g180.1.mk
Annotation PREDICTED: putative leucine-rich repeat receptor-like serine/threonine-protein kinase At2g19230
snpEff Effect intron_variant
Impact MODIFIER
Codon c.124+31T>C
Amino Acid
PCR Forward primer AAATGACTGATGCACTCCCC
Reverse primer CCTCAGGGGGATATGACAGA
Product size 287
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT


| Top |