Cherry SNP DataBase

SNP information

Name Pav_sc0004605.1_17527Y
Chr PAV_r1.0chr5
Pos (Chr) 7430475
PAV_r1.0 Pav_sc0004605.1
Pos (PAV_r1.0) 17527
REF T
ALT C
SSR motif
Gene Name Pav_sc0004605.1_g020.1.br
Annotation PREDICTED: subtilisin-like protease SDD1
snpEff Effect missense_variant
Impact MODERATE
Codon c.118A>G
Amino Acid p.Ile40Val
PCR Forward primer TTGCTTCATCAGCTGGTTTG
Reverse primer AAAAGGGTATGGCATTGCAG
Product size 227
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/REF REF/REF REF/ALT


| Top |