Cherry SNP DataBase

SNP information

Name Pav_sc0004605.1_18034Y
Chr PAV_r1.0chr5
Pos (Chr) 7429968
PAV_r1.0 Pav_sc0004605.1
Pos (PAV_r1.0) 18034
REF C
ALT T
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.18034C>T
Amino Acid
PCR Forward primer TGTCACAGATTAAACACGAGCA
Reverse primer ATTTTGCCAATGGAAACAGC
Product size 321
Enzymes for CAPS HaeIII
Exp. fragment size (REF) 70,21,230
Exp. fragment size (ALT) 70,251
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT REF/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT


| Top |