Cherry SNP DataBase

SNP information

Name Pav_sc0004687.1_12904M
Chr PAV_r1.0chr5
Pos (Chr) 11950241
PAV_r1.0 Pav_sc0004687.1
Pos (PAV_r1.0) 12904
REF C
ALT A
SSR motif
Gene Name Pav_sc0004687.1_g050.1.mk
Annotation hypothetical protein LR48_Vigan682s000600
snpEff Effect intron_variant
Impact MODIFIER
Codon c.10-3826C>A
Amino Acid
PCR Forward primer ACTGTCGTTGAGGTTGAGGC
Reverse primer GAAAGCCGAATAATGGACGA
Product size 323
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT REF/ALT


| Top |