Cherry SNP DataBase

SNP information

Name Pav_sc0004766.1_25810R
Chr PAV_r1.0chr2
Pos (Chr) 9705995
PAV_r1.0 Pav_sc0004766.1
Pos (PAV_r1.0) 25810
REF G
ALT A
SSR motif
Gene Name Pav_sc0004766.1_g050.1.mk
Annotation conserved hypothetical protein
snpEff Effect synonymous_variant
Impact LOW
Codon c.96C>T
Amino Acid p.His32His
PCR Forward primer GGAAGAACCCAAACAACCAA
Reverse primer ATCGTTTAAGGCAAACACCG
Product size 291
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/ALT REF/REF REF/ALT REF/REF


| Top |