Cherry SNP DataBase

SNP information

Name Pav_sc0005522.1_24301K
Chr PAV_r1.0chr4
Pos (Chr) 15085951
PAV_r1.0 Pav_sc0005522.1
Pos (PAV_r1.0) 24301
REF T
ALT G
SSR motif
Gene Name
Annotation
snpEff Effect
Impact
Codon
Amino Acid
PCR Forward primer AACCCTGAAAATGCTCATGC
Reverse primer TTTGAGAGGGTTTGATTGGC
Product size 298
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/REF ALT/ALT REF/ALT REF/ALT


| Top |