Cherry SNP DataBase

SNP information

Name Pav_sc0005787.1_11992R
Chr PAV_r1.0chr4
Pos (Chr) 26119450
PAV_r1.0 Pav_sc0005787.1
Pos (PAV_r1.0) 11992
REF G
ALT A
SSR motif
Gene Name
Annotation
snpEff Effect intergenic_region
Impact MODIFIER
Codon n.11992G>A
Amino Acid
PCR Forward primer AACGTCGCTTTCATCCTTTG
Reverse primer CTTGCCCATCAAGAGACTCC
Product size 252
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/ALT ALT/ALT ALT/ALT REF/ALT ALT/ALT REF/ALT


| Top |