Cherry SNP DataBase

SNP information

Name Pav_sc0005787.1_28180K
Chr PAV_r1.0chr4
Pos (Chr) 26135638
PAV_r1.0 Pav_sc0005787.1
Pos (PAV_r1.0) 28180
REF G
ALT T
SSR motif
Gene Name Pav_sc0005787.1_g040.1.mk
Annotation PREDICTED: pentatricopeptide repeat-containing protein At5g47360-like
snpEff Effect intron_variant
Impact MODIFIER
Codon c.1380+502G>T
Amino Acid
PCR Forward primer GGGACAAGGTCGATGAGGTA
Reverse primer TGACTCCATCGAACTCCACA
Product size 340
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/ALT


| Top |