Cherry SNP DataBase

SNP information

Name Pav_sc0005984.1_40695Y
Chr PAV_r1.0chr4
Pos (Chr) 13535762
PAV_r1.0 Pav_sc0005984.1
Pos (PAV_r1.0) 40695
REF T
ALT C
SSR motif
Gene Name Pav_sc0005984.1_g060.1.mk
Annotation PREDICTED: uncharacterized protein LOC103326194 isoform X1
snpEff Effect intron_variant
Impact MODIFIER
Codon c.192+48A>G
Amino Acid
PCR Forward primer GCTCGAAATAACACGCTTCC
Reverse primer TTGTATTGCAGGGTGTGGTG
Product size 347
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/REF REF/REF REF/ALT REF/REF REF/ALT


| Top |