Cherry SNP DataBase

SNP information

Name Pav_sc0006150.1_14713K
Chr PAV_r1.0chr8
Pos (Chr) 405223
PAV_r1.0 Pav_sc0006150.1
Pos (PAV_r1.0) 14713
REF G
ALT T
SSR motif
Gene Name Pav_sc0006150.1_g010.1.mk
Annotation PREDICTED: uncharacterized protein slp1 isoform X2
snpEff Effect missense_variant
Impact MODERATE
Codon c.306G>T
Amino Acid p.Leu102Phe
PCR Forward primer GCTGGACCAGGATGAACACT
Reverse primer GCCATTCTTTGGAGCATCAT
Product size 280
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/ALT REF/REF REF/ALT REF/ALT ALT/ALT REF/REF


| Top |