Cherry SNP DataBase

SNP information

Name Pav_sc0006673.1_8968K
Chr PAV_r1.0chr6
Pos (Chr) 13759432
PAV_r1.0 Pav_sc0006673.1
Pos (PAV_r1.0) 8968
REF T
ALT G
SSR motif
Gene Name Pav_sc0006673.1_g020.1.mk
Annotation PREDICTED: phospho-2-dehydro-3-deoxyheptonate aldolase 2, chloroplastic-like
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*29A>C
Amino Acid
PCR Forward primer AATGTGGTGGCTGCAATATG
Reverse primer GAGGCTCAATGCTTCTCAGG
Product size 207
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/ALT REF/REF REF/ALT


| Top |