Cherry SNP DataBase

SNP information

Name Pav_sc0006769.1_12057Y
Chr PAV_r1.0chr8
Pos (Chr) 2165583
PAV_r1.0 Pav_sc0006769.1
Pos (PAV_r1.0) 12057
REF T
ALT C
SSR motif
Gene Name Pav_sc0006769.1_g030.1.mk
Annotation
snpEff Effect intron_variant
Impact MODIFIER
Codon c.*312-74T>C
Amino Acid
PCR Forward primer TTGTTGCAAGCAGACTTTGG
Reverse primer CATCTGCGATCATCTCCTCA
Product size 234
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
ALT/ALT REF/REF REF/REF REF/REF REF/ALT ALT/ALT REF/REF


| Top |