Cherry SNP DataBase

SNP information

Name Pav_sc0007253.1_86631Y
Chr PAV_r1.0chr4
Pos (Chr) 8958072
PAV_r1.0 Pav_sc0007253.1
Pos (PAV_r1.0) 86631
REF C
ALT T
SSR motif
Gene Name Pav_sc0007253.1_g130.1.mk
Annotation PREDICTED: nuclear-pore anchor
snpEff Effect 3_prime_UTR_variant
Impact MODIFIER
Codon c.*2982G>A
Amino Acid
PCR Forward primer ACGACCTCTGATTGGTGGAG
Reverse primer AACTGAAGAAGCTGCCGATG
Product size 304
Enzymes for CAPS AfaI
Exp. fragment size (REF) 186,12,106
Exp. fragment size (ALT) 186,118
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/REF REF/ALT REF/ALT REF/REF REF/REF


| Top |