Cherry SNP DataBase

SNP information

Name Pav_sc0007519.1_13561R
Chr PAV_r1.0chr6
Pos (Chr) 13138299
PAV_r1.0 Pav_sc0007519.1
Pos (PAV_r1.0) 13561
REF G
ALT A
SSR motif
Gene Name Pav_sc0007519.1_g030.1.mk
Annotation PREDICTED: uncharacterized protein LOC103332547 isoform X1
snpEff Effect synonymous_variant
Impact LOW
Codon c.705C>T
Amino Acid p.Pro235Pro
PCR Forward primer CCTCTCGAGCCTTGTTTGAG
Reverse primer AAAGCCCATGATTTCTGTGG
Product size 347
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/ALT REF/REF REF/ALT REF/REF REF/ALT REF/REF REF/REF


| Top |