Cherry SNP DataBase

SNP information

Name Pav_sc0007769.1_4482R
Chr PAV_r1.0chr1
Pos (Chr) 555868
PAV_r1.0 Pav_sc0007769.1
Pos (PAV_r1.0) 4482
REF G
ALT A
SSR motif
Gene Name Pav_sc0007769.1_g020.1.mk
Annotation PREDICTED: UPF0098 protein CPn_0877/CP_0992/CPj0877/CpB0906
snpEff Effect stop_gained
Impact HIGH
Codon c.88C>T
Amino Acid p.Arg30*
PCR Forward primer AGGGCATCAATATCCTGCAC
Reverse primer TGGCTGCAATGAATTTAGCA
Product size 244
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/ALT REF/ALT REF/ALT REF/REF


| Top |