Cherry SNP DataBase

SNP information

Name Pav_sc0009701.1_2743Y
Chr PAV_r1.0chr6
Pos (Chr) 11322664
PAV_r1.0 Pav_sc0009701.1
Pos (PAV_r1.0) 2743
REF C
ALT T
SSR motif
Gene Name Pav_sc0009701.1_g010.1.mk
Annotation PREDICTED: transmembrane protein 194A
snpEff Effect synonymous_variant
Impact LOW
Codon c.556C>T
Amino Acid p.Leu186Leu
PCR Forward primer CCTGCAGGAAATTGTCAAAA
Reverse primer TTTGAGGAGCACCATCTGTG
Product size 250
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/REF REF/ALT REF/REF REF/REF REF/REF REF/REF


| Top |