Cherry SNP DataBase

SNP information

Name Pav_sc0010200.1_13256R
Chr PAV_r1.0chr6
Pos (Chr) 13593290
PAV_r1.0 Pav_sc0010200.1
Pos (PAV_r1.0) 13256
REF G
ALT A
SSR motif
Gene Name Pav_sc0010200.1_g030.1.mk
Annotation PREDICTED: calmodulin-binding transcription activator 3
snpEff Effect missense_variant
Impact MODERATE
Codon c.2072G>A
Amino Acid p.Arg691Gln
PCR Forward primer TCTTCATTGGGCAGCTTTTT
Reverse primer ATTGCCTTCCTTGATGTCCA
Product size 349
Enzymes for CAPS
Exp. fragment size (REF)
Exp. fragment size (ALT)
References
Germplasm List
Benikirari Benisayaka Benishuho Benitemari Beniyutaka Nanyo Satonishiki
REF/REF REF/ALT REF/ALT REF/REF REF/ALT REF/REF REF/ALT


| Top |